Transcriptional Regulatory Motifs Table View
 
Target Sequence >SerpinI1
ACTCCGGCGACGCCGGAAGGACCCAAGAGGAACCAGGCGTTGTCCGGAATCCTGCCCAGCCGGAGTCGTGCAGAGGCTTA
TGGGGACTCGTAGTCCCGCTCGCCGGCGTTGTCCGCAATTCCTGCAATCGGAAGACTACACTTCCCGGCAGGCCATGCGG
GGGATCCTGAGGCGATGGGTGGTGACACTTCTAGCCAATAGTAGGAGAATTCCCTGCCTTTGCGGGAGGAGGTGAGATGA
AGAGAGATGGTGCACGGAAAGGAGAGGAAGGGCGGGGCAAGCCCTCACCTGCGCCAATCAGGGTGCGGAGTAGGCCCCGC
AGGCGCCTCACCCATTGAGGGGGCGGGCTGACAGAGCAGAGGAAGGAAGGGGGTGAGGGGCCTGTGGTGGGGATCCTGGG
GCTGTCGGGCTGAGTATGCCGTGTGGGTGGAGAGGAAGCCTCGGGGAAATCGCCCAGGTGAAGGGAGGGCTTGGTGTGGG
GACTTGCACTGGGCAGAGGGGCAGCTTCCCTGAGAGCAGCTAAGCCCCAGGCACACCGGGCATCCGGACACACAGGTCGG
GGAAGGATAGGCTGAGCCGGGGCTCCCAGCAGAGACGCCTGGGTGGGGCAGGAGGCCGCTCCAGGTGTGAGCCACAGAGG
AGGGGAGAGGGACCCCCACGGGAGTGGAAGTGGCAGAGCAGCTGCAGAAGTGCAGGGAGCGGAAAGGTACCAGGGCAGCT
GCTTTCCGCTGCCTCCGGTCCGGGCAGCTGCAGAAACAGCAGGGGGAGGAGCAACAGCTGCCAAATTCGCCAACTAGAGG
AGGGAGAGGCGGAGCTTGGGTCCCTGTAGAAGCCAGAGGCGCAGTCTGGAC
 
No. RegRNA ID Strand Location Len Pattern Profile
1 R0146 - 334~338 5 TCAAT Show result profile
2 R0147 + 725~730 6 TCCGCT Show result profile
- 698~703 6 TCCGCT
3 R0150 - 148~153 6 GCCTGC Show result profile
- 319~324 6 GCCTGC
4 R0151 + 50~55 6 TCCTGC Show result profile
+ 120~125 6 TCCTGC
- 608~613 6 TCCTGC
5 R0188 - 530~535 6 TGTGCC Show result profile
6 R0190 + 547~552 6 GACACA Show result profile
7 R0191 + 637~644 8 GAGGAGGG Show result profile
+ 797~804 8 GAGGAGGG