RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1031
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern AAAGTAATACCTCCTATTTATTTCCCTGGAAACTACAGCAGTTACAAAGAGCACAATAACACTATTT
BindingProtein
References Dirksen WP, Mohamed SA, and Fisher SA
Splicing of a myosin phosphatase targeting subunit 1 alternative exon is regulated by intronic cis-elements and a novel bipartite exonic enhancer/silencer element.
J Biol Chem 2003; 278(11), 9722-32   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang