RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1029
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern AACCCCACCCCCTCACCCCGTTCGCGCCACCCCACTGTCTCACCTCACTGTGCCCTCACGCTCCATCCTGCCACACGCCCCTGCAG
BindingProtein PTB, Sam68, FBP
References Mulligan GJ, Guo W, Wormsley S, and Helfman DM
Polypyrimidine tract binding protein interacts with sequences involved in alternative splicing of beta-tropomyosin pre-mRNA.
J Biol Chem 1992; 267(35), 25480-7   PubMed 

Grossman JS, Meyer MI, Wang YC, Mulligan GJ, Kobayashi R, and Helfman DM
The use of antibodies to the polypyrimidine tract binding protein (PTB) to analyze the protein components that assemble on alternatively spliced pre-mRNAs that use distant branch points.
RNA 1998; 4(6), 613-25   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang