RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1028
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GCTGGGGCTGGGCAGAGCGCGCAGGGTTGAGGGGAGCAGGGTCCTTCACTGGGGTGAA
BindingProtein TLS
References Lerga A, Hallier M, Delva L, Orvain C, Gallais I, Marie J, and Moreau-Gachelin F
Identification of an RNA binding specificity for the potential splicing factor TLS.
J Biol Chem 2001; 276(9), 6807-16   PubMed 

Sirand-Pugnet P, Durosay P, Brody E, and Marie J
An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA.
Nucleic Acids Res 1995; 23(17), 3501-7   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang