RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1027
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern CCCCTCTCTCTATCGCTGTCTCTTGAGCCACGC
BindingProtein ASF/SF2, SC35, PTB, hnRNP K
References Expert-Bezançon A, Le Caer JP, and Marie J
Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a component of an intronic splicing enhancer complex that activates the splicing of the alternative exon 6A from chicken beta-tropomyosin pre-mRNA.
J Biol Chem 2002; 277(19), 16614-23   PubMed 

Gallego ME, Balvay L, and Brody E
cis-acting sequences involved in exon selection in the chicken beta-tropomyosin gene.
Mol Cell Biol 1992; 12(12), 5415-25   PubMed 

Balvay L, Libri D, Gallego M, and Fiszman MY
Intronic sequence with both negative and positive effects on the regulation of alternative transcripts of the chicken beta tropomyosin transcripts.
Nucleic Acids Res 1992; 20(15), 3987-92   PubMed 

Gallego ME, Gattoni R, Stévenin J, Marie J, and Expert-Bezançon A
The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A.
EMBO J 1997; 16(7), 1772-84   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang