RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1025
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern ATCACGCTGCCTGCTGCACCCCACCCCCTTCCCCCTTCCTTCCCCCCACCCCCGTACTCCACTGCCAACTCCC
BindingProtein
References Gooding C, Roberts GC, Moreau G, Nadal-Ginard B, and Smith CW
Smooth muscle-specific switching of alpha-tropomyosin mutually exclusive exon selection by specific inhibition of the strong default exon.
EMBO J 1994; 13(16), 3861-72   PubMed 

PĂ©rez I, Lin CH, McAfee JG, and Patton JG
Mutation of PTB binding sites causes misregulation of alternative 3` splice site selection in vivo.
RNA 1997; 3(7), 764-78   PubMed 

Gooding C, Roberts GC, and Smith CW
Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.
RNA 1998; 4(1), 85-100   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang