RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1023
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GGCGGCCAGAGGGTGTGCGGAGCTGGTGGGGAGGAGCTTGGAGAGAAGGGACAAAGCTGGGGGCTGAGGGAGAACCCCCA
BindingProtein SF2/ASF, hnRNP H
References Hastings ML, Ingle HA, Lazar MA, and Munroe SH
Post-transcriptional regulation of thyroid hormone receptor expression by cis-acting sequences and a naturally occurring antisense RNA.
J Biol Chem 2000; 275(15), 11507-13   PubMed 

Hastings ML, Wilson CM, and Munroe SH
A purine-rich intronic element enhances alternative splicing of thyroid hormone receptor mRNA.
RNA 2001; 7(6), 859-74   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang