RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1020
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern TAGTGAATAGAGTTAGGCAGGGA
BindingProtein hnRNP A1
References Tange TO, Damgaard CK, Guth S, Valcárcel J, and Kjems J
The hnRNP A1 protein regulates HIV-1 tat splicing via a novel intron silencer element.
EMBO J 2001; 20(20), 5748-58   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang