RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1019
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern CCTTGCCATTAACCGCGCTCTTCCTCTCCTCCCATCCACCACATGGTTATAG
BindingProtein
References Xie J, and Black DL
A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels.
Nature 2001; 410(6831), 936-9   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang