RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1017
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GCCAATCAGGTACAGTATCATCCTCTCATCTACACCATACTTTCACAGCGGTTG
BindingProtein Nova-1
References Buckanovich RJ, and Darnell RB
The neuronal RNA binding protein Nova-1 recognizes specific RNA targets in vitro and in vivo.
Mol Cell Biol 1997; 17(6), 3194-201   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang