RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1016
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GATTTGCATGTCGTACTGCATGTGTCCACTGTGCACACAATC
BindingProtein
References Kawamoto S
Neuron-specific alternative splicing of nonmuscle myosin II heavy chain-B pre-mRNA requires a cis-acting intron sequence.
J Biol Chem 1996; 271(30), 17613-6   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang