RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1014
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern GCCTCACGACCCAGCTGGGCCTTTGTCACATTGGGGGAGCCTGGTTTTTTCCTCTCATTCTCTTACTGTCTATACTTTAGTTCTTTGAATCTGGAGGAGTGGAACAGGTCCACTCTTTGGAAACTTGAACCTGGCTTTCTAGT
BindingProtein
References Kawahigashi H, Harada Y, Asano A, and Nakamura M
A cis-acting regulatory element that affects the alternative splicing of a muscle-specific exon in the mouse NCAM gene.
Biochim Biophys Acta 1998; 1397(3), 305-15   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang