RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1013
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern ATCCATCCCTCTATCTATCCCAGTTCAACCTGTCCAAAAGTGTTTTTGAAGAACCGCTTAAGCATAAGCAAAAAAA
BindingProtein
References Standiford DM, Sun WT, Davis MB, and Emerson CP
Positive and negative intronic regulatory elements control muscle-specific alternative exon splicing of Drosophila myosin heavy chain transcripts.
Genetics 2001; 157(1), 259-71   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang