RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1010
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GTTTAAGGGATGGTTGGTTGGTGGGG
BindingProtein
References Haut DD, and Pintel DJ
Intron definition is required for excision of the minute virus of mice small intron and definition of the upstream exon.
J Virol 1998; 72(3), 1834-43   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang