RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1009
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern AGTACTAAGCGGTGATGTTTCTGATCAG
BindingProtein
References Mühlemann O, Yue BG, Petersen-Mahrt S, and Akusjärvi G
A novel type of splicing enhancer regulating adenovirus pre-mRNA splicing.
Mol Cell Biol 2000; 20(7), 2317-25   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang