RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1008
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern GCGTGGAGGAATATGACGAGGACGATGAGTACGAGCCAGAGGACGGCGA
BindingProtein SR proteins
References Kanopka A, Mühlemann O, and Akusjärvi G
Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA.
Nature 1996; 381(6582), 535-8   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang