RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1007
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern CTGGATTATTAACTGAATGCCTCACTCAGAGAATGAA
BindingProtein
References Simard MJ, and Chabot B
Control of hnRNP A1 alternative splicing: an intron element represses use of the common 3` splice site.
Mol Cell Biol 2000; 20(19), 7353-62   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang