RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1006
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern CCTGCTCTGCTGTGCTACCTCCTCCTGGCTTTAAGCTGGGGCCGCCTCCCCAAAATAAGTAGGTGAATGAGTGGTTA
BindingProtein
References Blanchette M, and Chabot B
A highly stable duplex structure sequesters the 5` splice site region of hnRNP A1 alternative exon 7B.
RNA 1997; 3(4), 405-19   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang