RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1004
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern TAAGGAGTCTGTAAGTAATGGTTTCTGGAAAACCTGTACCTTTAGAGTAGGCTAGTAGAAACTAAACTTAGTGCATGACAAAGTTCGATCAGTCCCATAAATGTGCATG
BindingProtein hnRNP A1
References Chabot B, Blanchette M, Lapierre I, and La Branche H
An intron element modulating 5` splice site selection in the hnRNP A1 pre-mRNA interacts with hnRNP A1.
Mol Cell Biol 1997; 17(4), 1776-86   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang