RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R1002
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern CCGGAGTGCTCGAGAAACCAGCAACGGAGCGGCGAATCGACAAAGGGGAGGAAGTGGGAGAAACAACTGTGCAGCGAGATGCGAAGATGGCGCCGGAGGAAACGGCCACACCTAAAACCGTTGGCACATCCTGCTATCATTGCGGAACAGCTATTGGCTGTAATTGCGCCACAGCCTCGGCTCCCTCCTCCTCCTTATGTGGGGAGTGGTTTGTATCCTTCCCT
BindingProtein hnRNP H, SF2/ASF
References Fogel BL, and McNally MT
A cellular protein, hnRNP H, binds to the negative regulator of splicing element from Rous sarcoma virus.
J Biol Chem 2000; 275(41), 32371-8   PubMed 

McNally MT, Gontarek RR, and Beemon K
Characterization of Rous sarcoma virus intronic sequences that negatively regulate splicing.
Virology 1991; 185(1), 99-108   PubMed 

McNally LM, and McNally MT
SR protein splicing factors interact with the Rous sarcoma virus negative regulator of splicing element.
J Virol 1996; 70(2), 1163-72   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang