RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0997
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern TCTTAAAGGTTCTCTGCCCTGCATGGGAAGAAACATTGCTGAGAACCACTGTGCATGAACCCCCTCACTTGTGAGAGTTCACTGAATGACATTACGGCAATGCAGTAGTGTGTAGATAC
BindingProtein
References Huh GS, and Hynes RO
Elements regulating an alternatively spliced exon of the rat fibronectin gene.
Mol Cell Biol 1993; 13(9), 5301-14   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang