RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0996
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern TGGTGGGACCATAGGCAGCAC
BindingProtein
References Carstens RP, Wagner EJ, and Garcia-Blanco MA
An intronic splicing silencer causes skipping of the IIIb exon of fibroblast growth factor receptor 2 through involvement of polypyrimidine tract binding protein.
Mol Cell Biol 2000; 20(19), 7388-400   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang