RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0993
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern CAAACAAATTCAAAGAGAACGGACTCTGTGGGCTGATTTTTCCATGTGTTCAATCGC
BindingProtein
References Carstens RP, McKeehan WL, and Garcia-Blanco MA
An intronic sequence element mediates both activation and repression of rat fibroblast growth factor receptor 2 pre-mRNA splicing.
Mol Cell Biol 1998; 18(4), 2205-17   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang