RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0992
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern TGTGGGTTGATTTTTTCCATGCGTTTGATTGCGTGCATGTGTAGGAGGTGAAGCCGGTGT
BindingProtein
References Del Gatto F, Plet A, Gesnel MC, Fort C, and Breathnach R
Multiple interdependent sequence elements control splicing of a fibroblast growth factor receptor 2 alternative exon.
Mol Cell Biol 1997; 17(9), 5106-16   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang