RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0990
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern CTTTCATTTTTGTCTTTTTTT
BindingProtein
References Del Gatto-Konczak F, Bourgeois CF, Le Guiner C, Kister L, Gesnel MC, Stévenin J, and Breathnach R
The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5` splice site.
Mol Cell Biol 2000; 20(17), 6287-99   PubMed 

Del Gatto F, and Breathnach R
Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon.
Mol Cell Biol 1995; 15(9), 4825-34   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang