RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0989
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern ATCTGCCCCCACTCTGCTTCAGAAACTGCTGCCCACTAACATTGCTCCCTGCCTGCCGCGTG
BindingProtein
References Jin W, Bi W, Huang ES, and Cote GJ
Glioblastoma cell-specific expression of fibroblast growth factor receptor-1beta requires an intronic repressor of RNA splicing.
Cancer Res 1999; 59(2), 316-9   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang