RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0988
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern AATGCTGCTACAGCTGCTTCCTAACTTTGCCTCTTTCTTC
BindingProtein PTB
References Jin W, Huang ES, Bi W, and Cote GJ
Redundant intronic repressors function to inhibit fibroblast growth factor receptor-1 alpha-exon recognition in glioblastoma cells.
J Biol Chem 1999; 274(39), 28035-41   PubMed 

Jin W, McCutcheon IE, Fuller GN, Huang ES, and Cote GJ
Fibroblast growth factor receptor-1 alpha-exon exclusion and polypyrimidine tract-binding protein in glioblastoma multiforme tumors.
Cancer Res 2000; 60(5), 1221-4   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang