RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0986
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern TGAGGCTGGGGGCTGCTCTCTGCATGTGCTTCCT
BindingProtein PTB/nPTB, KSRP, FBP,hnRNP H, hnRNP F
References Markovtsov V, Nikolic JM, Goldman JA, Turck CW, Chou MY, and Black DL
Cooperative assembly of an hnRNP complex induced by a tissue-specific homolog of polypyrimidine tract binding protein.
Mol Cell Biol 2000; 20(20), 7463-79   PubMed 

Black DL
Activation of c-src neuron-specific splicing by an unusual RNA element in vivo and in vitro.
Cell 1992; 69(5), 795-807   PubMed 

Chan RC, and Black DL
The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream.
Mol Cell Biol 1997; 17(8), 4667-76   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang