RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0984
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern GGGCCCTGTCTTCGCACCTCAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGGCCCTT
BindingProtein PTB/nPTB
References Chan RC, and Black DL
The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream.
Mol Cell Biol 1997; 17(8), 4667-76   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang