RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0983
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern CTCTTTCTCTTTAACCCTGTGCCTGCCTGTCTTGCTGTCTGTCTTCCCCCACCTAACTCCTTCTCCTAACGGTTTTCCTCAAG
BindingProtein PTB, CUG-BP
References Zhang L, Liu W, and Grabowski PJ
Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB.
RNA 1999; 5(1), 117-30   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang