RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0981
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern ATTTCTGCTTGACTCTTCCAAATCTTCCTTCTCTTACCCTTGCATTTTCTCTCTGT
BindingProtein PTB
References Côté J, Dupuis S, and Wu JY
Polypyrimidine track-binding protein binding downstream of caspase-2 alternative exon 9 represses its inclusion.
J Biol Chem 2001; 276(11), 8535-43   PubMed 

Coté J, Dupuis S, Jiang Z, and Wu JY
Caspase-2 pre-mRNA alternative splicing: Identification of an intronic element containing a decoy 3` acceptor site.
Proc Natl Acad Sci U S A 2001; 98(3), 938-43   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang