RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0977
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern ACTGCACCTTTCTTTGTTCCATCTCTCCACCTCTGCTGTG
BindingProtein PTB, ETR-3
References Charlet-B N, Logan P, Singh G, and Cooper TA
Dynamic antagonism between ETR-3 and PTB regulates cell type-specific alternative splicing.
Mol Cell 2002; 9(3), 649-58   PubMed 

Cooper TA
Muscle-specific splicing of a heterologous exon mediated by a single muscle-specific splicing enhancer from the cardiac troponin T gene.
Mol Cell Biol 1998; 18(8), 4519-25   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang