RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0975
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern CTCCGCTCCTCTTCCAGGTAAGAC
BindingProtein PTB*, ASF/SF2*,
References Lou H, Yang Y, Cote GJ, Berget SM, and Gagel RF
An intron enhancer containing a 5` splice site sequence in the human calcitonin/calcitonin gene-related peptide gene.
Mol Cell Biol 1995; 15(12), 7135-42   PubMed 

Lou H, Gagel RF, and Berget SM
An intron enhancer recognized by splicing factors activates polyadenylation.
Genes Dev 1996; 10(2), 208-19   PubMed 

Lou H, Neugebauer KM, Gagel RF, and Berget SM
Regulation of alternative polyadenylation by U1 snRNPs and SRp20.
Mol Cell Biol 1998; 18(9), 4977-85   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang