RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0972
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern CCAAGGGAAAGCATGGGTTAACCTA
BindingProtein
References Hedjran F, Yeakley JM, Huh GS, Hynes RO, and Rosenfeld MG
Control of alternative pre-mRNA splicing by distributed pentameric repeats.
Proc Natl Acad Sci U S A 1997; 94(23), 12343-7   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang