RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0968
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GCCCAGGCTGGAGTGCAGTA
BindingProtein
References Genetta T, Morisaki H, Morisaki T, and Holmes EW
A novel bipartite intronic splicing enhancer promotes the inclusion of a mini-exon in the AMP deaminase 1 gene.
J Biol Chem 2001; 276(27), 25589-97   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang