RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0966
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern ATCTTTTGTAGCCATTCCTAGAGAGCCCTTTCCC
BindingProtein
References Wei N, Lin CQ, Modafferi EF, Gomes WA, and Black DL
A unique intronic splicing enhancer controls the inclusion of the agrin Y exon.
RNA 1997; 3(11), 1275-88   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang