RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0965
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern CCTTGTCTGTGTGTCTAACTGTGTGCAC
BindingProtein ETR-3*, Brul*
References Suzuki H, Jin Y, Otani H, Yasuda K, and Inoue K
Regulation of alternative splicing of alpha-actinin transcript by Bruno-like proteins.
Genes Cells 2002; 7(2), 133-41   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang