RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0963
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern ATTTATTTTTAAATATTTTTTGGTTTGCCAATTTTCAGTTTTTCCCG
BindingProtein
References Deguillien M, Huang SC, Morinière M, Dreumont N, Benz EJ, and Baklouti F
Multiple cis elements regulate an alternative splicing event at 4.1R pre-mRNA during erythroid differentiation.
Blood 2001; 98(13), 3809-16   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang