RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0962
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern AATGTATGGGTGTAGTGTCTTGTATAATAGAAATTGTTCCACTGATAATTTACTCTAGTTTTTTATTTCCTCATATTATTTTCAGTGGCTTTTTCTTCCACATCTTTATATTTTGCACCACATTCAACACTGTATCTTGCACATGGCG
BindingProtein SF2/ASF, SC35, SRp75
References Pagani F, Buratti E, Stuani C, Romano M, Zuccato E, Niksic M, Giglio L, Faraguna D, and Baralle FE
Splicing factors induce cystic fibrosis transmembrane regulator exon 9 skipping through a nonevolutionary conserved intronic element.
J Biol Chem 2000; 275(28), 21041-7   PubMed 

Pagani F, Stuani C, Zuccato E, Kornblihtt AR, and Baralle FE
Promoter architecture modulates CFTR exon 9 skipping.
J Biol Chem 2003; 278(3), 1511-7   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang