RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0958
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GTAAGTCAGGCTGCATGCCTCCCACCACACCTGTGCTGCATGACACCTGGGGCTGACCTGCAACAGAAGTGGGGCTGAGGGAAGGACTGTCCTGGGGACTGGTGTCAGAGCGGGGTTGGTGACTCTCAGGATGCCCAAAATGCCCA
BindingProtein
References Carlo T, Sterner DA, and Berget SM
An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon.
RNA 1996; 2(4), 342-53   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang