RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0953
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GTAGTGGGACCCAGAGACGGCAGAAGGGTGGGTGGAGTCTGAATGGAG
BindingProtein
References Kosaki A, Nelson J, and Webster NJ
Identification of intron and exon sequences involved in alternative splicing of insulin receptor pre-mRNA.
J Biol Chem 1998; 273(17), 10331-7   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang