RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0951
Feature Type Intronic Splicing RegRNA
Class Intron silencer
Name Intron silencer
Pattern CCCTCTCTCTATCGCTGTCTCTTGAGCCACGCC
BindingProtein
References Libri D, Piseri A, and Fiszman MY
Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on an RNA secondary structure.
Science 1991; 252(5014), 1842-5   PubMed 

Libri D, Goux-Pelletan M, Brody E, and Fiszman MY
Exon as well as intron sequences are cis-regulating elements for the mutually exclusive alternative splicing of the beta tropomyosin gene.
Mol Cell Biol 1990; 10(10), 5036-46   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang