RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0948
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern AGGCTGGGGGCTGCTCTCTGCATGTGCTTCCT
BindingProtein KSRP, p53/hnRNP F
References Min H, Turck CW, Nikolic JM, and Black DL
A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer.
Genes Dev 1997; 11(8), 1023-36   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang