RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0943
Feature Type Intronic Splicing RegRNA
Class Intron enhancer
Name Intron enhancer
Pattern GCGCTTCTTCCCTTCCCTCCTCCCTGGCTCAG
BindingProtein
References Ryan KJ, and Cooper TA
Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle.
Mol Cell Biol 1996; 16(8), 4014-23   PubMed 

Cooper TA
Muscle-specific splicing of a heterologous exon mediated by a single muscle-specific splicing enhancer from the cardiac troponin T gene.
Mol Cell Biol 1998; 18(8), 4519-25   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang