RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0938
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern AAGAGGAAGAATGGCTTGAGGAAGACGACG
BindingProtein
References Tanaka K, Watakabe A, and Shimura Y
Polypurine sequences within a downstream exon function as a splicing enhancer.
Mol Cell Biol 1994; 14(2), 1347-54   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang