RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0930
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern GGAAAGTCTGATTGAAGAGGAAGCCAGGCAGAAGAAGA
BindingProtein
References Steingrimsdottir H, Rowley G, Dorado G, Cole J, and Lehmann AR
Mutations which alter splicing in the human hypoxanthine-guanine phosphoribosyltransferase gene.
Nucleic Acids Res 1992; 20(6), 1201-8   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang