RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0907
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern TTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAG
BindingProtein SRp55
References Yang Y, Swaminathan S, Martin BK, and Sharan SK
Aberrant splicing induced by missense mutations in BRCA1: clues from a humanized mouse model.
Hum Mol Genet 2003; 12(17), 2121-31   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang