RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0904
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern TGTCTCTTCTTTGCTCGGCTCCCCCGCCTGCGGTCCCATCAGAGCAG
BindingProtein U2AF(65), PTB, SR Proteins
References Zheng ZM, He PJ, and Baker CC
Function of a bovine papillomavirus type 1 exonic splicing suppressor requires a suboptimal upstream 3` splice site.
J Virol 1999; 73(1), 29-36   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang