RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0903
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern TCGACATTGGGAGCAGTCGGCTCGTGC
BindingProtein SRp40
References Tacke R, Chen Y, and Manley JL
Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer.
Proc Natl Acad Sci U S A 1997; 94(4), 1148-53   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang