RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0900
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern CCAATAGTAGTAGCGGGAGAATG
BindingProtein ASF/SF2, SC35
References Caputi M, and Zahler AM
SR proteins and hnRNP H regulate the splicing of the HIV-1 tev-specific exon 6D.
EMBO J 2002; 21(4), 845-55   PubMed 

Wentz MP, Moore BE, Cloyd MW, Berget SM, and Donehower LA
A naturally arising mutation of a potential silencer of exon splicing in human immunodeficiency virus type 1 induces dominant aberrant splicing and arrests virus production.
J Virol 1997; 71(11), 8542-51   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang